Online Inquiry
CCDC6 Knockout Cell Line
SPL-00806
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | CCDC6 |
| Gene Abbr. | CCDC6 |
| Gene ID | 8030 |
| Full Name | coiled-coil domain containing 6 |
| Alias | D10S170, H4, PTC, TPC, TST1 |
| Species | Human |
| Genomic Locus | chr10:59852564 |
| Transcript | NM_005436 |
| WT Expression Level | 18.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a coiled-coil domain-containing protein. The encoded protein is ubiquitously expressed and may function as a tumor suppressor. A chromosomal rearrangement resulting in the expression of a fusion gene containing a portion of this gene and the intracellular kinase-encoding domain of the ret proto-oncogene is the cause of thyroid papillary carcinoma.[provided by RefSeq, Sep 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CCDC6. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCTGGAGAGCTCATTAGTG |
| PCR Primer |
Forward: GAACTTAAGCTACAACCTCATCAGC Reverse: TGGGTACCCTTTCTGGAAATAAGAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.