Online Inquiry
CBX1 Knockout Cell Line
SPL-00801
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | HP1β |
| Gene Abbr. | CBX1 |
| Gene ID | 10951 |
| Full Name | chromobox 1 |
| Alias | CBX, HP1-BETA, HP1Hs-beta, HP1Hsbeta, M31 |
| Species | Human |
| Genomic Locus | chr17:48076914 |
| Transcript | NM_001127228 |
| WT Expression Level | 111.69 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family . The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The protein may play an important role in the epigenetic control of chromatin structure and gene expression. Several related pseudogenes are located on chromosomes 1, 3, and X. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of CBX1. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAAGTTCTCGACCGTCGAG |
| PCR Primer |
Forward: GACTGAGTCACACTGTATCCATCAT Reverse: ATATTATCACCTGTCATGTCCCTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.