CBL cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

CBL cDNA ORF Clone, Human, N-Myc tag

CBL cDNA ORF Clone, Human, N-Myc tag

SPD-02394

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Cas-Br-M (murine) ecotropic retroviral transforming sequence with N terminal Myc tag.
Target Information
Species Human
Target Name c-Cbl
Gene Abbr. CBL
Gene ID 867
Full Name Cbl proto-oncogene
Alias C-CBL, CBL2, FRA11B, NSLL, RNF55
Introduction The c-Cbl proto-oncogene is a ubiquitously expressed cytoplasmic adaptor protein that is especially predominant in hematopoietic cells. c-Cbl is rapidly tyrosine-phosphorylated in response to stimulation of a variety of cell-surface receptors and becomes associated with a number of intracellular signaling molecules such as protein tyrosine kinases, phosphatidylinositol-3 kinase, Crk, and 14-3-3 proteins. c-Cbl possesses a highly conserved amino-terminal phosphotyrosine binding domain (TKB) and a C3HC4 RING finger motif. The TKB recognizes phosphorylated tyrosines on activated receptor tyrosine kinases (RTKs) as well as other nonreceptor tyrosine kinases. The RING finger motif recruits ubiquitin-conjugating enzymes. These two domains are primarily responsible for the ubiquitin ligase activity of c-Cbl and downregulation of RTKs. Research studies have indicated that in human cancer tissues, c-Cbl is frequently tyrosine-phosphorylated in a tumor-specific manner. Phosphorylation of Tyr731 of c-Cbl provides a docking site for downstream signaling components such as p85 and Fyn.
Product Details
Description Full length Clone DNA of Human Cas-Br-M (murine) ecotropic retroviral transforming sequence with N terminal Myc tag.
NCBI Ref Seq NM_005188.2
RefSeq ORF Size 2766 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6kb + 2.77kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.