Casp9 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Casp9 cDNA ORF Clone, Mouse, untagged

Casp9 cDNA ORF Clone, Mouse, untagged

SPD-02375

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse caspase 9
Target Information
Species Mouse
Target Name Caspase-9
Gene Abbr. Casp9
Gene ID 12371
Full Name caspase 9
Alias AI115399, APAF-3, AW493809, CASP-9, Casp
Introduction Caspase-9 (ICE-LAP6, Mch6) is an important member of the cysteine aspartic acid protease (caspase) family. Upon apoptotic stimulation, cytochrome c released from mitochondria associates with the 47 kDa procaspase-9/Apaf-1. Apaf-1 mediated activation of caspase-9 involves intrinsic proteolytic processing resulting in cleavage at Asp315 and producing a p35 subunit. Another cleavage occurs at Asp330 producing a p37 subunit that can serve to amplify the apoptotic response. Cleaved caspase-9 further processes other caspase members, including caspase-3 and caspase-7, to initiate a caspase cascade, which leads to apoptosis.
Product Details
Description Full length Clone DNA of Mouse caspase 9
NCBI Ref Seq NM_015733.5
RefSeq ORF Size 1365 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 498C/G,1068C/A not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.37kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.