Online Inquiry
CASP9 cDNA ORF Clone, Human, C-FLAG tag
SPD-02376
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human caspase 9, apoptosis-related cysteine peptidase with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Caspase-9 |
Gene Abbr. | CASP9 |
Gene ID | 842 |
Full Name | caspase 9 |
Alias | APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56 |
Introduction | Caspase-9 (ICE-LAP6, Mch6) is an important member of the cysteine aspartic acid protease (caspase) family. Upon apoptotic stimulation, cytochrome c released from mitochondria associates with the 47 kDa procaspase-9/Apaf-1. Apaf-1 mediated activation of caspase-9 involves intrinsic proteolytic processing resulting in cleavage at Asp315 and producing a p35 subunit. Another cleavage occurs at Asp330 producing a p37 subunit that can serve to amplify the apoptotic response. Cleaved caspase-9 further processes other caspase members, including caspase-3 and caspase-7, to initiate a caspase cascade, which leads to apoptosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human caspase 9, apoptosis-related cysteine peptidase with C terminal Flag tag. |
NCBI Ref Seq | NM_001229.2 |
RefSeq ORF Size | 1251 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.29kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.