Online Inquiry
CASP8 cDNA ORF Clone, Human, C-His tag
SPD-02365
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Caspase-8 |
| Gene Abbr. | CASP8 |
| Gene ID | 841 |
| Full Name | caspase 8 |
| Alias | ALPS2B, CAP4, Casp-8, FLICE, MACH |
| Introduction | Apoptosis induced through the CD95 receptor (Fas/APO-1) and tumor necrosis factor receptor 1 (TNFR1) activates caspase-8 and leads to the release of the caspase-8 active fragments, p18 and p10. Activated caspase-8 cleaves and activates downstream effector caspases such as caspase-1, -3, -6, and -7. Caspase-3 ultimately elicits the morphological hallmarks of apoptosis, including DNA fragmentation and cell shrinkage. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with C terminal His tag. |
| NCBI Ref Seq | NM_033355.3 |
| RefSeq ORF Size | 1440 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.