CASP8 cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

CASP8 cDNA ORF Clone, Human, C-HA tag

CASP8 cDNA ORF Clone, Human, C-HA tag

SPD-02367

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with C terminal HA tag.
Target Information
Species Human
Target Name Caspase-8
Gene Abbr. CASP8
Gene ID 841
Full Name caspase 8
Alias ALPS2B, CAP4, Casp-8, FLICE, MACH
Introduction Apoptosis induced through the CD95 receptor (Fas/APO-1) and tumor necrosis factor receptor 1 (TNFR1) activates caspase-8 and leads to the release of the caspase-8 active fragments, p18 and p10. Activated caspase-8 cleaves and activates downstream effector caspases such as caspase-1, -3, -6, and -7. Caspase-3 ultimately elicits the morphological hallmarks of apoptosis, including DNA fragmentation and cell shrinkage.
Product Details
Description Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with C terminal HA tag.
NCBI Ref Seq NM_033355.3
RefSeq ORF Size 1482 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.48kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.