Online Inquiry
CASP7 cDNA ORF Clone, Human, N-FLAG tag
SPD-02359
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Caspase-7 |
Gene Abbr. | CASP7 |
Gene ID | 840 |
Full Name | caspase 7 |
Alias | CASP-7, CMH-1, ICE-LAP3, LICE2, MCH3 |
Introduction | Caspase-7 (CMH-1, Mch3, ICE-LAP3) has been identified as a major contributor to the execution of apoptosis. Caspase-7, like caspase-3, is an effector caspase that is responsible for cleaving downstream substrates such as (ADP-ribose) polymerase and PARP. During apoptosis, caspase-7 is activated through proteolytic processing by upstream caspases at Asp23, Asp198, and Asp206 to produce the mature subunits. Similar to caspase-2 and -3, caspase-7 preferentially cleaves substrates following the recognition sequence DEVD. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with N terminal Flag tag. |
NCBI Ref Seq | NM_001227.3 |
RefSeq ORF Size | 912 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.