CASP7 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

CASP7 cDNA ORF Clone, Human, C-Myc tag

CASP7 cDNA ORF Clone, Human, C-Myc tag

SPD-02356

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with C terminal Myc tag.
Target Information
Species Human
Target Name Caspase-7
Gene Abbr. CASP7
Gene ID 840
Full Name caspase 7
Alias CASP-7, CMH-1, ICE-LAP3, LICE2, MCH3
Introduction Caspase-7 (CMH-1, Mch3, ICE-LAP3) has been identified as a major contributor to the execution of apoptosis. Caspase-7, like caspase-3, is an effector caspase that is responsible for cleaving downstream substrates such as (ADP-ribose) polymerase and PARP. During apoptosis, caspase-7 is activated through proteolytic processing by upstream caspases at Asp23, Asp198, and Asp206 to produce the mature subunits. Similar to caspase-2 and -3, caspase-7 preferentially cleaves substrates following the recognition sequence DEVD.
Product Details
Description Full length Clone DNA of Human caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with C terminal Myc tag.
NCBI Ref Seq NM_001227.3
RefSeq ORF Size 957 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.96kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.