Online Inquiry
CASP6 cDNA ORF Clone, Human, N-FLAG tag
SPD-02348
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human caspase 6, apoptosis-related cysteine peptidase with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Caspase-6 |
Gene Abbr. | CASP6 |
Gene ID | 839 |
Full Name | caspase 6 |
Alias | MCH2 |
Introduction | Caspase-6 (Mch2) is one of the major executioner caspases functioning in cellular apoptotic processes. Upon apoptotic stimulation, initiator caspases such as caspase-9 are cleaved and activated. The activated upstream caspases further process downstream executioner caspases, such as caspase-3 and caspase-6, by cleaving them into large and small subunits, thereby initiating a caspase cascade leading to apoptosis. One of the major targets for caspase-6 is the membrane associated protein lamin A. The cleavage of this protein causes cell membrane malfunction, membrane blebbing and eventual cell death. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human caspase 6, apoptosis-related cysteine peptidase with N terminal Flag tag. |
NCBI Ref Seq | BC000305 |
RefSeq ORF Size | 882 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.