CASP6 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

CASP6 cDNA ORF Clone, Human, C-His tag

CASP6 cDNA ORF Clone, Human, C-His tag

SPD-02344

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human caspase 6, apoptosis-related cysteine peptidase with C terminal His tag.
Target Information
Species Human
Target Name Caspase-6
Gene Abbr. CASP6
Gene ID 839
Full Name caspase 6
Alias MCH2
Introduction Caspase-6 (Mch2) is one of the major executioner caspases functioning in cellular apoptotic processes. Upon apoptotic stimulation, initiator caspases such as caspase-9 are cleaved and activated. The activated upstream caspases further process downstream executioner caspases, such as caspase-3 and caspase-6, by cleaving them into large and small subunits, thereby initiating a caspase cascade leading to apoptosis. One of the major targets for caspase-6 is the membrane associated protein lamin A. The cleavage of this protein causes cell membrane malfunction, membrane blebbing and eventual cell death.
Product Details
Description Full length Clone DNA of Human caspase 6, apoptosis-related cysteine peptidase with C terminal His tag.
NCBI Ref Seq BC000305
RefSeq ORF Size 882 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.