CASP5 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CASP5 cDNA ORF Clone, Human, untagged

CASP5 cDNA ORF Clone, Human, untagged

SPD-02342

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human caspase 5, apoptosis-related cysteine peptidase, transcript variant a.
Target Information
Species Human
Target Name Caspase-5
Gene Abbr. CASP5
Gene ID 838
Full Name caspase 5
Alias ICE(rel)III, ICEREL-III, ICH-3
Introduction Caspase-5 (Ich-3/ICErelIII/TY) is a member of the caspase family of cysteine proteases that play a key role in the execution of apoptosis and activation of inflammatory cytokines. Caspase-5 is widely expressed, with highest expression observed in placenta and lung. Interferon-γ and LPS regulate expression of caspase-5. Members of the caspase-1 subfamily of caspases, which includes caspase-4, -5, and murine caspase-11 and -12, can induce apoptosis when over-expressed and mediate the proteolytic activation of inflammatory cytokines. Processing of IL-1β occurs through the activation of an inflammasome complex consisting of caspase-1, caspase-5, Pycard and NALP1. Transcription factor Max, a component of the Myc/Mad/Max network, is cleaved by caspase-5 during Fas-induced apoptosis. Several alternative spliced variants of caspase-5 have been identified. Frameshift mutations of caspase-5 have been observed in leukemia, lymphoma and colorectal cancers.
Product Details
Description Full length Clone DNA of Human caspase 5, apoptosis-related cysteine peptidase, transcript variant a.
NCBI Ref Seq NM_004347.3
RefSeq ORF Size 1305 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.31kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.