Online Inquiry
CASP5 cDNA ORF Clone, Human, N-Myc tag
SPD-02340
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase 5, apoptosis-related cysteine peptidase, transcript variant a with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Caspase-5 |
| Gene Abbr. | CASP5 |
| Gene ID | 838 |
| Full Name | caspase 5 |
| Alias | ICE(rel)III, ICEREL-III, ICH-3 |
| Introduction | Caspase-5 (Ich-3/ICErelIII/TY) is a member of the caspase family of cysteine proteases that play a key role in the execution of apoptosis and activation of inflammatory cytokines. Caspase-5 is widely expressed, with highest expression observed in placenta and lung. Interferon-γ and LPS regulate expression of caspase-5. Members of the caspase-1 subfamily of caspases, which includes caspase-4, -5, and murine caspase-11 and -12, can induce apoptosis when over-expressed and mediate the proteolytic activation of inflammatory cytokines. Processing of IL-1β occurs through the activation of an inflammasome complex consisting of caspase-1, caspase-5, Pycard and NALP1. Transcription factor Max, a component of the Myc/Mad/Max network, is cleaved by caspase-5 during Fas-induced apoptosis. Several alternative spliced variants of caspase-5 have been identified. Frameshift mutations of caspase-5 have been observed in leukemia, lymphoma and colorectal cancers. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase 5, apoptosis-related cysteine peptidase, transcript variant a with N terminal Myc tag. |
| NCBI Ref Seq | NM_004347.3 |
| RefSeq ORF Size | 1350 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 1.35kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.