CASP4 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

CASP4 cDNA ORF Clone, Human, N-His tag

CASP4 cDNA ORF Clone, Human, N-His tag

SPD-02330

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human caspase 4, apoptosis-related cysteine peptidase, transcript variant alpha with N terminal His tag.
Target Information
Species Human
Target Name Caspase-4
Gene Abbr. CASP4
Gene ID 837
Full Name caspase 4
Alias ICE(rel)II, ICEREL-II, ICH-2, Mih1, Mih1/TX
Introduction Caspase-4 (TX/ICH-2/ICErelII) is a member of the caspase family of proteases that play a key role in the execution of apoptosis and activation of inflammatory cytokines. Expression of caspase-4 has been observed in most tissues except brain, with highest levels in placenta, lung, spleen, and peripheral blood lymphocytes (PBL). Caspase-4 was originally found to contribute to Fas-mediated apoptosis. Several caspases (including caspase-4, caspase-5, and mouse caspase-11 and -12) are most closely related to caspase-1 and are capable of inducing apoptosis when over-expressed but are better characterized in the proteolytic activation of inflammatory cytokines. Caspase-4 associates with TRAF6 and is involved in the LPS inducible production of inflammatory cytokines IL-8 and MIP1 in THP-1 cells. While caspase-4 and mouse caspase-12 localize to the endoplasmic reticulum (ER) and may be activated by drugs that induce ER-stress at least one study suggests that caspase-4 and caspase-12 are not essential for the ER-stress induced apoptosis.
Product Details
Description Full length Clone DNA of Human caspase 4, apoptosis-related cysteine peptidase, transcript variant alpha with N terminal His tag.
NCBI Ref Seq NM_001225.3
RefSeq ORF Size 1134 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.