Online Inquiry
CASP4 cDNA ORF Clone, Human, C-Myc tag
SPD-02326
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase 4, apoptosis-related cysteine peptidase, transcript variant alpha with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Caspase-4 |
| Gene Abbr. | CASP4 |
| Gene ID | 837 |
| Full Name | caspase 4 |
| Alias | ICE(rel)II, ICEREL-II, ICH-2, Mih1, Mih1/TX |
| Introduction | Caspase-4 (TX/ICH-2/ICErelII) is a member of the caspase family of proteases that play a key role in the execution of apoptosis and activation of inflammatory cytokines. Expression of caspase-4 has been observed in most tissues except brain, with highest levels in placenta, lung, spleen, and peripheral blood lymphocytes (PBL). Caspase-4 was originally found to contribute to Fas-mediated apoptosis. Several caspases (including caspase-4, caspase-5, and mouse caspase-11 and -12) are most closely related to caspase-1 and are capable of inducing apoptosis when over-expressed but are better characterized in the proteolytic activation of inflammatory cytokines. Caspase-4 associates with TRAF6 and is involved in the LPS inducible production of inflammatory cytokines IL-8 and MIP1 in THP-1 cells. While caspase-4 and mouse caspase-12 localize to the endoplasmic reticulum (ER) and may be activated by drugs that induce ER-stress at least one study suggests that caspase-4 and caspase-12 are not essential for the ER-stress induced apoptosis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase 4, apoptosis-related cysteine peptidase, transcript variant alpha with C terminal Myc tag. |
| NCBI Ref Seq | NM_001225.3 |
| RefSeq ORF Size | 1179 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 858A/G not causing the amino acid variation. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 1.18kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.