Online Inquiry
CASP3 cDNA ORF Clone, Human, untagged
SPD-02313
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase 3, apoptosis-related cysteine peptidase (CASP3), transcript variant alpha. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Caspase-3 |
| Gene Abbr. | CASP3 |
| Gene ID | 836 |
| Full Name | caspase 3 |
| Alias | CPP32, CPP32B, SCA-1 |
| Introduction | Caspase-3 (CPP-32, Apoptain, Yama, SCA-1) is a critical executioner of apoptosis, as it is either partially or totally responsible for the proteolytic cleavage of many key proteins, such as the nuclear enzyme poly (ADP-ribose) polymerase (PARP). Activation of caspase-3 requires proteolytic processing of its inactive zymogen into activated p17 and p12 fragments. Cleavage of caspase-3 requires the aspartic acid residue at the P1 position. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase 3, apoptosis-related cysteine peptidase (CASP3), transcript variant alpha. |
| NCBI Ref Seq | NM_004346.3 |
| RefSeq ORF Size | 834 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 0.83kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.