Online Inquiry
CASP2 Knockout Cell Line
SPL-00782
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | Caspase-2 |
| Gene Abbr. | CASP2 |
| Gene ID | 835 |
| Full Name | caspase 2 |
| Alias | CASP-2, ICH1, NEDD-2, NEDD2, PPP1R57 |
| Species | Human |
| Genomic Locus | chr7:143292351 |
| Transcript | NM_032982 |
| WT Expression Level | 19.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Caspases mediate cellular apoptosis through the proteolytic cleavage of specific protein substrates. The encoded protein may function in stress-induced cell death pathways, cell cycle maintenance, and the suppression of tumorigenesis. Increased expression of this gene may play a role in neurodegenerative disorders including Alzheimer's disease, Huntington's disease and temporal lobe epilepsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of CASP2. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAAGCTTGGGGACCCCTCTT |
| PCR Primer |
Forward: TCACCCATACATACACTTTTCCTGT Reverse: GTCTCCCTCACTCTGACTTACAAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.