Casp2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Casp2 cDNA ORF Clone, Mouse, untagged

Casp2 cDNA ORF Clone, Mouse, untagged

SPD-02273

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse capping protein (actin filament) muscle Z-line, beta.
Target Information
Species Mouse
Target Name Caspase-2
Gene Abbr. Casp2
Gene ID 12366
Full Name caspase 2
Alias CASP-2, Casp, ICH-1, Ich-, NEDD-2
Introduction Caspase-2 (Nedd2/ICH-1) is a Class I caspase with a long prodomain necessary for nuclear localization. Upon activation of the apoptotic pathway, the procaspase is cleaved at Asp316, producing a 14 kDa fragment and a 32 kDa prodomain/large subunit. Subsequent processing at Asp152 and Asp330 produces an 18 kDa large subunit and a 12 kDa small fragment. Caspase-2 is the nuclear apoptotic respondent to cellular genotoxic stress or mitotic catastrophe. Activation occurs upon recruitment to a complex containing a p53-induced death domain protein, PIDD. This suggests caspase-2 can be a nuclear initiator caspase with a requirement for caspase-9 and caspase-3 activation in downstream apoptotic events. In apoptotic pathways resulting from UV-induced DNA damage, processing of caspase-2 occurs downstream of mitochondrial dysfunction and of caspase-9 and caspase-3 activation, extending a possible role for caspase-2 as a parallel effector caspase.
Product Details
Description Full length Clone DNA of Mouse capping protein (actin filament) muscle Z-line, beta.
NCBI Ref Seq NM_009798.4
RefSeq ORF Size 819 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.