Online Inquiry
Casp2 cDNA ORF Clone, Mouse, N-HA tag
SPD-02281
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse caspase 2 with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Caspase-2 |
Gene Abbr. | Casp2 |
Gene ID | 12366 |
Full Name | caspase 2 |
Alias | CASP-2, Casp, ICH-1, Ich-, NEDD-2 |
Introduction | Caspase-2 (Nedd2/ICH-1) is a Class I caspase with a long prodomain necessary for nuclear localization. Upon activation of the apoptotic pathway, the procaspase is cleaved at Asp316, producing a 14 kDa fragment and a 32 kDa prodomain/large subunit. Subsequent processing at Asp152 and Asp330 produces an 18 kDa large subunit and a 12 kDa small fragment. Caspase-2 is the nuclear apoptotic respondent to cellular genotoxic stress or mitotic catastrophe. Activation occurs upon recruitment to a complex containing a p53-induced death domain protein, PIDD. This suggests caspase-2 can be a nuclear initiator caspase with a requirement for caspase-9 and caspase-3 activation in downstream apoptotic events. In apoptotic pathways resulting from UV-induced DNA damage, processing of caspase-2 occurs downstream of mitochondrial dysfunction and of caspase-9 and caspase-3 activation, extending a possible role for caspase-2 as a parallel effector caspase. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse caspase 2 with N terminal HA tag. |
NCBI Ref Seq | NM_007610.1 |
RefSeq ORF Size | 1359 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.