Casp14 cDNA ORF Clone, Rat, C-His tag - CD BioSciences

service-banner

Casp14 cDNA ORF Clone, Rat, C-His tag

Casp14 cDNA ORF Clone, Rat, C-His tag

SPD-02245

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat caspase 14 with C terminal His tag.
Target Information
Species Rat
Target Name Caspase-14
Gene Abbr. Casp14
Gene ID 299587
Full Name caspase 14
Introduction Caspases are a family of cysteine proteases that play an essential role in carrying out apoptosis. Caspase-14, also named MICE, is a unique member of the caspase family with restricted expression; it is found in embryonic tissues and adult skin. Caspase-14 is weakly processed into p18 and p11 subunits by caspase-8. Caspase-14 may not play a role in , but instead may regulate keratinocyte differentiation. Expression of caspase-14 may protect from psoriasis and irradiation damage. Caspase-14 may also be responsible for proteolytic processing of filaggrin during terminal differentiation of keratinocytes.
Product Details
Description Full length Clone DNA of Rat caspase 14 with C terminal His tag.
NCBI Ref Seq NM_001191776.1
RefSeq ORF Size 741 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.