Online Inquiry
CASP14 cDNA ORF Clone, Human, untagged
SPD-02263
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase 14, apoptosis-related cysteine peptidase. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Caspase-14 |
| Gene Abbr. | CASP14 |
| Gene ID | 23581 |
| Full Name | caspase 14 |
| Alias | ARCI12 |
| Introduction | Caspases are a family of cysteine proteases that play an essential role in carrying out apoptosis. Caspase-14, also named MICE, is a unique member of the caspase family with restricted expression; it is found in embryonic tissues and adult skin. Caspase-14 is weakly processed into p18 and p11 subunits by caspase-8. Caspase-14 may not play a role in , but instead may regulate keratinocyte differentiation. Expression of caspase-14 may protect from psoriasis and irradiation damage. Caspase-14 may also be responsible for proteolytic processing of filaggrin during terminal differentiation of keratinocytes. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase 14, apoptosis-related cysteine peptidase. |
| NCBI Ref Seq | BC069541 |
| RefSeq ORF Size | 729 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 0.73kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.