Online Inquiry
CASP1 cDNA ORF Clone, Human, N-HA tag
SPD-02230
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase), transcript variant alpha with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Caspase-1 |
| Gene Abbr. | CASP1 |
| Gene ID | 834 |
| Full Name | caspase 1 |
| Alias | ICE, IL1BC, P45 |
| Introduction | Caspase-1, or interleukin-1ß converting enzyme (ICE/ICEα), is a class I cysteine protease, which also includes caspases -4, -5, -11, and -12. Caspase-1 cleaves inflammatory cytokines such as pro-IL-1ß and interferon-γ inducing factor (IL-18) into their mature forms. Like other caspases, caspase-1 is proteolytically activated from a proenzyme to produce a tetramer of its two active subunits, p20 and p10. Caspase-1 has a large amino-terminal pro-domain that contains a caspase recruitment domain (CARD). Overexpression of caspase-1 can induce apoptosis. Mice deficient in caspase-1, however, have no overt defects in apoptosis but do have defects in the maturation of pro-IL-1β and are resistant to endotoxic shock. At least six caspase-1 isoforms have been identified, including caspase-1 α, β, γ, δ, ε and ζ. Most caspase-1 isoforms (α, β, γ and δ) produce products between 30-48 kDa and induce apoptosis upon over-expression. Caspase-1 ε typically contains only the p10 subunit, does not induce apoptosis and may act as a dominant negative. The widely expressed ζ isoform of caspase-1 induces apoptosis and lacks 39 amino-terminal residues found in the α isoform. Activation of caspase-1 occurs through an oligomerization molecular platform designated the "inflammasome" that includes caspase-5, Pycard/Asc, and NALP1. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase), transcript variant alpha with N terminal HA tag. |
| NCBI Ref Seq | NM_033293.3 |
| RefSeq ORF Size | 978 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 0.98kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.