CASP1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

CASP1 cDNA ORF Clone, Human, N-FLAG tag

CASP1 cDNA ORF Clone, Human, N-FLAG tag

SPD-02227

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase), transcript variant alpha with N terminal Flag tag.
Target Information
Species Human
Target Name Caspase-1
Gene Abbr. CASP1
Gene ID 834
Full Name caspase 1
Alias ICE, IL1BC, P45
Introduction Caspase-1, or interleukin-1ß converting enzyme (ICE/ICEα), is a class I cysteine protease, which also includes caspases -4, -5, -11, and -12. Caspase-1 cleaves inflammatory cytokines such as pro-IL-1ß and interferon-γ inducing factor (IL-18) into their mature forms. Like other caspases, caspase-1 is proteolytically activated from a proenzyme to produce a tetramer of its two active subunits, p20 and p10. Caspase-1 has a large amino-terminal pro-domain that contains a caspase recruitment domain (CARD). Overexpression of caspase-1 can induce apoptosis. Mice deficient in caspase-1, however, have no overt defects in apoptosis but do have defects in the maturation of pro-IL-1β and are resistant to endotoxic shock. At least six caspase-1 isoforms have been identified, including caspase-1 α, β, γ, δ, ε and ζ. Most caspase-1 isoforms (α, β, γ and δ) produce products between 30-48 kDa and induce apoptosis upon over-expression. Caspase-1 ε typically contains only the p10 subunit, does not induce apoptosis and may act as a dominant negative. The widely expressed ζ isoform of caspase-1 induces apoptosis and lacks 39 amino-terminal residues found in the α isoform. Activation of caspase-1 occurs through an oligomerization molecular platform designated the "inflammasome" that includes caspase-5, Pycard/Asc, and NALP1.
Product Details
Description Full length Clone DNA of Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase), transcript variant alpha with N terminal Flag tag.
NCBI Ref Seq NM_033293.3
RefSeq ORF Size 975 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.98kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.