Online Inquiry
CARM1 Knockout Cell Line
SPL-00779
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | PRMT4 |
| Gene Abbr. | CARM1 |
| Gene ID | 10498 |
| Full Name | coactivator associated arginine methyltransferase 1 |
| Alias | PRMT4 |
| Species | Human |
| Genomic Locus | chr19:10908097 |
| Transcript | NM_199141 |
| WT Expression Level | 107.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CARM1. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGTGTTCAGCGAGCGGACGG |
| PCR Primer |
Forward: TGTAACTGCTCTACCGTTATTCACA Reverse: TTCAAGGGAGAAACGTCAGGACATA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.