CARM1 Knockout Cell Line - CD BioSciences

service-banner

CARM1 Knockout Cell Line

CARM1 Knockout Cell Line

SPL-00779

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name PRMT4
Gene Abbr. CARM1
Gene ID 10498
Full Name coactivator associated arginine methyltransferase 1
Alias PRMT4
Species Human
Genomic Locus chr19:10908097
Transcript NM_199141
WT Expression Level 107.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CARM1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TGTGTTCAGCGAGCGGACGG
PCR Primer Forward: TGTAACTGCTCTACCGTTATTCACA
Reverse: TTCAAGGGAGAAACGTCAGGACATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.