Online Inquiry
CARD11 cDNA ORF Clone, Human, untagged
SPD-02221
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human caspase recruitment domain family member 11. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CARD11 |
| Gene Abbr. | CARD11 |
| Gene ID | 84433 |
| Full Name | caspase recruitment domain family member 11 |
| Alias | BENTA, BIMP3, CARMA1, IMD11, IMD11A |
| Introduction | CARD11/Carma1/Bimp3 belongs to the MAGUK (membrane-associated guanylate kinase) family that typically function as molecular scaffolds in the assembly of multiprotein complexes. MAGUK family members contain an SH3 domain, a PDZ domain and a GuK domain homologous to guanylate kinase. In addition, CARD11 contains an amino-terminal CARD domain (caspase recruitment domain). This domain plays an important role in forming interactions with a number of proteins containing CARD domains that are involved in regulating apoptosis and NF-κB activation. CARD11 is predominately expressed in lymphocytes and associates with the CARD domain of Bcl10. When overexpressed, CARD11 leads to the phosphorylation of Bcl10 and activation of NF-κB. CARD11 is constitutively associated with lipid rafts and is thought to function by recruiting Bcl10 and MALT1 and triggering the phosphorylation of IKKs. Several studies using the genetic disruption of CARD11 or dominant-negative mutations have demonstrated that it plays a critical role in NF-κB activation and lymphocyte signaling. Phosphorylation at multiple sites within the central region of CARD11 regulates NF-κB activation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human caspase recruitment domain family member 11. |
| NCBI Ref Seq | NM_001324281.1 |
| RefSeq ORF Size | 3465 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3276A/G not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 2.28kb + 1.19kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.