Capza2 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Capza2 cDNA ORF Clone, Rat, untagged

Capza2 cDNA ORF Clone, Rat, untagged

SPD-02210

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat capping protein (actin filament) muscle Z-line, alpha 2.
Target Information
Species Rat
Target Name CAPZA2
Gene Abbr. Capza2
Gene ID 493810
Full Name capping actin protein of muscle Z-line subunit alpha 2
Product Details
Description Full length Clone DNA of Rat capping protein (actin filament) muscle Z-line, alpha 2.
NCBI Ref Seq NM_001009180.2
RefSeq ORF Size 861 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.