Capza1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Capza1 cDNA ORF Clone, Mouse, untagged

Capza1 cDNA ORF Clone, Mouse, untagged

SPD-02190

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse capping protein (actin filament) muscle Z-line, alpha 1.
Target Information
Species Mouse
Target Name CAPZA1
Gene Abbr. Capza1
Gene ID 12340
Full Name capping protein (actin filament) muscle Z-line, alpha 1
Alias CAPZ, CAZ1, Ca, Cappa1, capZ alpha-1
Product Details
Description Full length Clone DNA of Mouse capping protein (actin filament) muscle Z-line, alpha 1.
NCBI Ref Seq NM_009797.2
RefSeq ORF Size 861 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.