Online Inquiry
CAPZA1 cDNA ORF Clone, Canine, untagged
SPD-02180
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine capping protein (actin filament) muscle Z-line, alpha 1. |
Target Information | |
---|---|
Species | Canine |
Target Name | CAPZA1 |
Gene Abbr. | CAPZA1 |
Gene ID | 475857 |
Full Name | capping actin protein of muscle Z-line subunit alpha 1 |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine capping protein (actin filament) muscle Z-line, alpha 1. |
NCBI Ref Seq | XM_533066.4 |
RefSeq ORF Size | 861 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.