Camkv cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Camkv cDNA ORF Clone, Mouse, untagged

Camkv cDNA ORF Clone, Mouse, untagged

SPD-02159

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse CaM kinase-like vesicle-associated.
Target Information
Species Mouse
Target Name CAMKV
Gene Abbr. Camkv
Gene ID 235604
Full Name CaM kinase-like vesicle-associated
Alias 1G5, BB074618, BC017634
Product Details
Description Full length Clone DNA of Mouse CaM kinase-like vesicle-associated.
NCBI Ref Seq NM_145621.2
RefSeq ORF Size 1539 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.