Online Inquiry
CAMKV cDNA ORF Clone, Human, untagged
SPD-02149
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human CaM kinase-like vesicle-associated. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CAMKV |
| Gene Abbr. | CAMKV |
| Gene ID | 79012 |
| Full Name | CaM kinase like vesicle associated |
| Alias | 1G5, VACAMKL |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human CaM kinase-like vesicle-associated. |
| NCBI Ref Seq | BC017363 |
| RefSeq ORF Size | 1506 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.