Camk4 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Camk4 cDNA ORF Clone, Mouse, C-FLAG tag

Camk4 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-02079

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase IV with C terminal Flag tag.
Target Information
Species Mouse
Target Name CaMKIV
Gene Abbr. Camk4
Gene ID 12326
Full Name calcium/calmodulin-dependent protein kinase IV
Alias A430110E23Rik, AI666733, CaM, CaMKI, CaMKIV
Introduction CaMKIV is an important member of calcium/calmodulin-activated kinases. CaMKIV signaling has been related to long-term neural potentiation and memory, as well as T-cell receptor signaling. CaMKIV has catalytic and regulatory domains. The Ca2+/calmodulin-dependent CaMKK phosphorylates CaMKIV, releasing the autoinhibitory effect and thus activating the kinase. The activated CaMKIV further autophosphorylates itself at Thr196 (or Thr200 in human) to render the kinase constitutively active. The threonine phosphorylation state of CaMKIV can be downregulated by PP2A dephosphorylation.
Product Details
Description Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase IV with C terminal Flag tag.
NCBI Ref Seq NM_009793.3
RefSeq ORF Size 1410 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.