Online Inquiry
CAMK4 cDNA ORF Clone, Human, N-HA tag
SPD-02097
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase IV with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CaMKIV |
Gene Abbr. | CAMK4 |
Gene ID | 814 |
Full Name | calcium/calmodulin dependent protein kinase IV |
Alias | CaMK IV, CaMK-GR, CaMKIV, caMK |
Introduction | CaMKIV is an important member of calcium/calmodulin-activated kinases. CaMKIV signaling has been related to long-term neural potentiation and memory, as well as T-cell receptor signaling. CaMKIV has catalytic and regulatory domains. The Ca2+/calmodulin-dependent CaMKK phosphorylates CaMKIV, releasing the autoinhibitory effect and thus activating the kinase. The activated CaMKIV further autophosphorylates itself at Thr196 (or Thr200 in human) to render the kinase constitutively active. The threonine phosphorylation state of CaMKIV can be downregulated by PP2A dephosphorylation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase IV with N terminal HA tag. |
NCBI Ref Seq | NM_001744.4 |
RefSeq ORF Size | 1422 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.