CAMK2G cDNA ORF Clone, Ferret, untagged - CD BioSciences

service-banner

CAMK2G cDNA ORF Clone, Ferret, untagged

CAMK2G cDNA ORF Clone, Ferret, untagged

SPD-02078

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Ferret calcium>calmodulin-dependent protein kinase II gamma.
Target Information
Species Ferret
Target Name CaMKII-γ
Gene Abbr. CAMK2G
Gene ID 101681123
Full Name calcium/calmodulin dependent protein kinase II gamma
Product Details
Description Full length Clone DNA of Ferret calcium>calmodulin-dependent protein kinase II gamma.
NCBI Ref Seq XM_004769400.1
RefSeq ORF Size 1488 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.