Online Inquiry
CAMK2D Knockout Cell Line
SPL-00772
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | CAMK2D |
| Gene Abbr. | CAMK2D |
| Gene ID | 817 |
| Full Name | calcium/calmodulin dependent protein kinase II delta |
| Alias | CAMKD |
| Species | Human |
| Genomic Locus | chr4:113661716 |
| Transcript | NM_172128 |
| WT Expression Level | 15.43 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CAMK2D. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TATTAGGGTGCTTCAAAAGA |
| PCR Primer |
Forward: TGTAACCAAGATTGAAAGTTAGGAACC Reverse: GGCCTTTTGTCATTTTGTTATGCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.