CAMK1G cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

CAMK1G cDNA ORF Clone, Human, C-FLAG tag

CAMK1G cDNA ORF Clone, Human, C-FLAG tag

SPD-02099

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase II alpha with C terminal Flag tag.
Target Information
Species Human
Target Name CaMKI-γ
Gene Abbr. CAMK1G
Gene ID 57172
Full Name calcium/calmodulin dependent protein kinase IG
Alias CLICK3, CLICKIII, VWS1, dJ272L16.1
Product Details
Description Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase II alpha with C terminal Flag tag.
NCBI Ref Seq NM_171825.1
RefSeq ORF Size 1476 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1377t/c not causing the amino acid variation.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6kb + 1.48kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.