Online Inquiry
CAMK1D Knockout Cell Line
SPL-00770
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
16bp deletion |
Target Information | |
---|---|
Target Name | CaMKI-δ |
Gene Abbr. | CAMK1D |
Gene ID | 57118 |
Full Name | calcium/calmodulin dependent protein kinase ID |
Alias | CKLiK, CaM-K1, CaMKID |
Species | Human |
Genomic Locus | chr10:12760960 |
Transcript | NM_020397 |
WT Expression Level | 6.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of CAMK1D. |
Description | 16bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGAGCTGTTTGACCGGATAG |
PCR Primer |
Forward: TTTACTTGGTTCCAGACATTTGCTC Reverse: AAGACTTGGCGGATCAGAGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.