CAMK1D cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

CAMK1D cDNA ORF Clone, Human, N-His tag

CAMK1D cDNA ORF Clone, Human, N-His tag

SPD-02126

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase ID with N terminal His tag.
Target Information
Species Human
Target Name CaMKI-δ
Gene Abbr. CAMK1D
Gene ID 57118
Full Name calcium/calmodulin dependent protein kinase ID
Alias CKLiK, CaM-K1, CaMKID
Introduction The Ca2+/calmodulin-dependent kinase (CaMK) family, which is activated in response to elevation of intracellular Ca2+, includes CaMKI, CaMKII, CaMKIV and CaMK-kinases (CaMKKs). CaMKI is a downstream substrate of CaMKK and has 4 isoforms: CaMKI-α, CaMKI-β, CaMKI-γ and CaMKI-δ. CaMKI is present in most cell types and may be involved in cellular functions including transcription, cytoskeletal organization, axonal growth cone motility and long-term potentiation in neurons. CaMKII is also ubiquitously expressed in most cell types. While muscular CaMKII has been linked to activation of mitochondrial biogenesis in muscle hypertrophy response, neuronal CaMKII regulates important neuronal functions, including neurotransmitter synthesis, neurotransmitter release, modulation of ion channel activity, cellular transport, cell morphology and neurite extension, synaptic plasticity, learning and memory and gene expression. Like CaMKI, CaMKIV is also a substrate of CaMKKs and is primarily restricted to the nucleus of neurons. CaMKIV regulates gene transcription in neurons through phosphorylation of transcription factors such as CREB and is required for fear memory.Ca
Product Details
Description Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase ID with N terminal His tag.
NCBI Ref Seq NM_153498.2
RefSeq ORF Size 1158 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.