Online Inquiry
CAMK1D cDNA ORF Clone, Human, C-Myc tag
SPD-02122
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase ID with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CaMKI-δ |
| Gene Abbr. | CAMK1D |
| Gene ID | 57118 |
| Full Name | calcium/calmodulin dependent protein kinase ID |
| Alias | CKLiK, CaM-K1, CaMKID |
| Introduction | The Ca2+/calmodulin-dependent kinase (CaMK) family, which is activated in response to elevation of intracellular Ca2+, includes CaMKI, CaMKII, CaMKIV and CaMK-kinases (CaMKKs). CaMKI is a downstream substrate of CaMKK and has 4 isoforms: CaMKI-α, CaMKI-β, CaMKI-γ and CaMKI-δ. CaMKI is present in most cell types and may be involved in cellular functions including transcription, cytoskeletal organization, axonal growth cone motility and long-term potentiation in neurons. CaMKII is also ubiquitously expressed in most cell types. While muscular CaMKII has been linked to activation of mitochondrial biogenesis in muscle hypertrophy response, neuronal CaMKII regulates important neuronal functions, including neurotransmitter synthesis, neurotransmitter release, modulation of ion channel activity, cellular transport, cell morphology and neurite extension, synaptic plasticity, learning and memory and gene expression. Like CaMKI, CaMKIV is also a substrate of CaMKKs and is primarily restricted to the nucleus of neurons. CaMKIV regulates gene transcription in neurons through phosphorylation of transcription factors such as CREB and is required for fear memory.Ca |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase ID with C terminal Myc tag. |
| NCBI Ref Seq | NM_153498.2 |
| RefSeq ORF Size | 1158 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.