Online Inquiry
Calml5 cDNA ORF Clone, Rat, untagged
SPD-01955
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat calmodulin-like 5. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | CALML5 |
| Gene Abbr. | Calml5 |
| Gene ID | 364774 |
| Full Name | calmodulin-like 5 |
| Alias | Calm4 |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat calmodulin-like 5. |
| NCBI Ref Seq | XM_001062982.2 |
| RefSeq ORF Size | 444 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.