Online Inquiry
Calm1 cDNA ORF Clone, Rat, N-HA tag
SPD-01964
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat calmodulin 1 with N terminal HA tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | Calmodulin |
Gene Abbr. | Calm1 |
Gene ID | 24244 |
Full Name | calmodulin 2 |
Alias | CaMI, Calm, Cam1 |
Introduction | Calmodulin is a ubiquitously expressed small protein mediating many cellular effects such as short-term and long-term memory, nerve growth, inflammation, apoptosis, muscle contraction and intracellular movement. Upon binding of four Ca2+ ions, calmodulin undergoes conformational changes, allowing this complex to bind to and activate many enzymes including protein kinases, protein phosphatases, ion channels, Ca2+ pumps, nitric oxide synthase, inositol triphosphate kinase, and cyclic nucleotide phosphodiesterase. Since calmodulin binds Ca2+ in a cooperative fashion, small changes in cytosolic Ca2+ levels lead to large changes in the level of active calmodulin and its target proteins. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat calmodulin 1 with N terminal HA tag. |
NCBI Ref Seq | NM_031969.2 |
RefSeq ORF Size | 450 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.