Calm1 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Calm1 cDNA ORF Clone, Mouse, C-HA tag

Calm1 cDNA ORF Clone, Mouse, C-HA tag

SPD-01969

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse calmodulin 1 with C terminal HA tag.
Target Information
Species Mouse
Target Name Calmodulin
Gene Abbr. Calm1
Gene ID 12315
Full Name calmodulin 3
Alias AI256814, AI327027, AI461935, AL024000, CaM
Introduction Calmodulin is a ubiquitously expressed small protein mediating many cellular effects such as short-term and long-term memory, nerve growth, inflammation, apoptosis, muscle contraction and intracellular movement. Upon binding of four Ca2+ ions, calmodulin undergoes conformational changes, allowing this complex to bind to and activate many enzymes including protein kinases, protein phosphatases, ion channels, Ca2+ pumps, nitric oxide synthase, inositol triphosphate kinase, and cyclic nucleotide phosphodiesterase. Since calmodulin binds Ca2+ in a cooperative fashion, small changes in cytosolic Ca2+ levels lead to large changes in the level of active calmodulin and its target proteins.
Product Details
Description Full length Clone DNA of Mouse calmodulin 1 with C terminal HA tag.
NCBI Ref Seq NM_009790.4
RefSeq ORF Size 450 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.