Online Inquiry
CAD cDNA ORF Clone, Human, untagged
SPD-01920
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CAD |
| Gene Abbr. | CAD |
| Gene ID | 790 |
| Full Name | carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
| Alias | CDG1Z, DEE50, EIEE50, GATD4 |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
| NCBI Ref Seq | NM_004341.3 |
| RefSeq ORF Size | 6678 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | HindIII (four restriction sites) + NotI (6.1kb + 4.39kb + 0.29kb + 1.81kb + 0.21kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.