CACNB4 Knockout Cell Line - CD BioSciences

service-banner

CACNB4 Knockout Cell Line

CACNB4 Knockout Cell Line

SPL-00764

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name CACNB4
Gene Abbr. CACNB4
Gene ID 785
Full Name calcium voltage-gated channel auxiliary subunit beta 4
Alias CAB4, CACNLB4, EA5, EIG9, EJM
Species Human
Genomic Locus chr2:151883295
Transcript NM_000726
WT Expression Level 2.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of CACNB4.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence GGACCGGGAAGCAATTCGAC
PCR Primer Forward: ATTCCAGAAATGTGAGGTAAGGGAA
Reverse: ATATCTGCAATAAGGCATGGAGTGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.