Online Inquiry
CACNB3 Knockout Cell Line
SPL-00762
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | CACNB3 |
| Gene Abbr. | CACNB3 |
| Gene ID | 784 |
| Full Name | calcium voltage-gated channel auxiliary subunit beta 3 |
| Alias | CAB3, CACNLB3 |
| Species | Human |
| Genomic Locus | chr12:48823420 |
| Transcript | NM_001206916 |
| WT Expression Level | 29.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a regulatory beta subunit of the voltage-dependent calcium channel. Beta subunits are composed of five domains, which contribute to the regulation of surface expression and gating of calcium channels and may also play a role in the regulation of transcription factors and calcium transport. [provided by RefSeq, Oct 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of CACNB3. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGGCTCTCTACTTCACGCC |
| PCR Primer |
Forward: AATAGAGGCAACACTGTAAGGTGAG Reverse: CCCTCTCACACTCAAGGACATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.