Online Inquiry
CACNA2D2 Knockout Cell Line
SPL-00758
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | CACNA2D2 |
Gene Abbr. | CACNA2D2 |
Gene ID | 9254 |
Full Name | calcium voltage-gated channel auxiliary subunit alpha2delta 2 |
Alias | CACNA2D, CASVDD |
Species | Human |
Genomic Locus | chr3:50434396 |
Transcript | NM_006030 |
WT Expression Level | 25.58 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of CACNA2D2. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CCGGAACCTGTTCGAGGTAC |
PCR Primer |
Forward: GCAGCTACTCCAGATAGTATCATCC Reverse: CAACCACAATGACCAGCCTAAAC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.