Online Inquiry
CACNA2D1 Knockout Cell Line
SPL-00756
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | CACNA2D1 |
| Gene Abbr. | CACNA2D1 |
| Gene ID | 781 |
| Full Name | calcium voltage-gated channel auxiliary subunit alpha2delta 1 |
| Alias | CACNA2, CACNL2A, CCHL2A, LINC01112, lncRNA-N3 |
| Species | Human |
| Genomic Locus | chr7:82335193 |
| Transcript | NM_000722 |
| WT Expression Level | 8.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The preproprotein encoded by this gene is cleaved into multiple chains that comprise the alpha-2 and delta subunits of the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. Mutations in this gene can cause cardiac deficiencies, including Brugada syndrome and short QT syndrome. Alternate splicing results in multiple transcript variants, some of which may lack the delta subunit portion. [provided by RefSeq, Nov 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of CACNA2D1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACCAGCTGGCGTGCATTATT |
| PCR Primer |
Forward: ATACCAAAACCCCTCAATAGAGCAT Reverse: CTGACACACTCAAACTCCAAAAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.