CACNA1H Knockout Cell Line - CD BioSciences

service-banner

CACNA1H Knockout Cell Line

CACNA1H Knockout Cell Line

SPL-00754

Size Price
1 Unit Online Inquiry
Description
1bp deletion
Target Information
Target Name CACNA1H
Gene Abbr. CACNA1H
Gene ID 8912
Full Name calcium voltage-gated channel subunit alpha1 H
Alias CACNA1HB, Cav3.2, ECA6, EIG6, HALD4
Species Human
Genomic Locus chr16:1194975
Transcript NM_001005407
WT Expression Level 0.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of CACNA1H.
Description 1bp deletion
Parental Cell Line C631
Guide RNA Sequence GTTCGAGCACGTGAGCATGC
PCR Primer Forward: CTTTCCTGATGAGCCAACGC
Reverse: GAACCATAAACCTCGTAGCGACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.