Cab39 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Cab39 cDNA ORF Clone, Mouse, N-FLAG tag

Cab39 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-01894

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse calcium binding protein 39 with N terminal Flag tag.
Target Information
Species Mouse
Target Name CAB39
Gene Abbr. Cab39
Gene ID 12283
Full Name calcium binding protein 39
Alias 39kD, AA408805, AA960512, C78372, MO25
Introduction AMPK (AMP-activated protein kinase) is a key cellular component that regulates energy homeostasis. When the AMP/ATP ratio is increased due to energy depletion, AMPK is phosphorylated at its α1 and α2 catalytic subunits and activated. Studies showed that the tumor suppressor LKB1 phosphorylates and activates AMPK in mammals. MO25α (mouse protein 25α), also called CAB39 (calcium binding protein 39), is a component of the LKB1 complex in vivo. MO25α/CAB39 does not directly interact with LKB1; instead, it is physically associated with STRADα. Together MO25α/CAB39 and STRADα help anchor LKB1 in the cytoplasm. MO25α/CAB39 stablizes the LKB1-STRADα complex and further increases the catalytic activity of LKB1.
Product Details
Description Full length Clone DNA of Mouse calcium binding protein 39 with N terminal Flag tag.
NCBI Ref Seq NM_133781.4
RefSeq ORF Size 1026 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.