Online Inquiry
Cab39 cDNA ORF Clone, Mouse, C-HA tag
SPD-01893
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse calcium binding protein 39 with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CAB39 |
Gene Abbr. | Cab39 |
Gene ID | 12283 |
Full Name | calcium binding protein 39 |
Alias | 39kD, AA408805, AA960512, C78372, MO25 |
Introduction | AMPK (AMP-activated protein kinase) is a key cellular component that regulates energy homeostasis. When the AMP/ATP ratio is increased due to energy depletion, AMPK is phosphorylated at its α1 and α2 catalytic subunits and activated. Studies showed that the tumor suppressor LKB1 phosphorylates and activates AMPK in mammals. MO25α (mouse protein 25α), also called CAB39 (calcium binding protein 39), is a component of the LKB1 complex in vivo. MO25α/CAB39 does not directly interact with LKB1; instead, it is physically associated with STRADα. Together MO25α/CAB39 and STRADα help anchor LKB1 in the cytoplasm. MO25α/CAB39 stablizes the LKB1-STRADα complex and further increases the catalytic activity of LKB1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse calcium binding protein 39 with C terminal HA tag. |
NCBI Ref Seq | NM_133781.4 |
RefSeq ORF Size | 1026 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.