C8G cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

C8G cDNA ORF Clone, Human, untagged

C8G cDNA ORF Clone, Human, untagged

SPD-03721

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component 8, gamma polypeptide.
Target Information
Species Human
Target Name Complement C8G
Gene Abbr. C8G
Gene ID 733
Full Name complement C8 gamma chain
Alias C8C
Product Details
Description Full length Clone DNA of Human complement component 8, gamma polypeptide.
NCBI Ref Seq BC113626
RefSeq ORF Size 609 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.